View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7135_high_5 (Length: 241)
Name: NF7135_high_5
Description: NF7135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7135_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 8570032 - 8569809
Alignment:
| Q |
1 |
tttgaccttggaagagcactctatgttttgactgtctcttttctgattaaccgctctcaaagtacta-gaatatttggctatggaaatgcagaactttaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8570032 |
tttgaccttggaagagcactctatgttttgactgtctcttttctgattaactgctctcaaagtactaagaatatttggctatggaaatgcagaactttaa |
8569933 |
T |
 |
| Q |
100 |
tttcagtttgattgcttttgttaacaaatgtcagcaacacactcctttggtgggttcatgtgaatttttaaccaatcaaaaatactatttacattttatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8569932 |
tttcagtttgattgcttttgttaacaaatgctagcaacacactcttttcgtgggttcatgtgaatttttaaccaatcaaaaatactatttatattttatt |
8569833 |
T |
 |
| Q |
200 |
ttcattatagtaatgtgacatatg |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8569832 |
ttcattatagtaatgtgacatatg |
8569809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University