View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7135_high_6 (Length: 210)

Name: NF7135_high_6
Description: NF7135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7135_high_6
NF7135_high_6
[»] chr7 (1 HSPs)
chr7 (146-196)||(19823923-19823973)


Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 19823973 - 19823923
Alignment:
146 acatgctttatacttgaatggtttggcattgagcgagcataggaataactt 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
19823973 acatgctttatacttgaatggtttggcattgagcgagcataggaataactt 19823923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University