View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7135_low_6 (Length: 210)
Name: NF7135_low_6
Description: NF7135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7135_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 19823973 - 19823923
Alignment:
| Q |
146 |
acatgctttatacttgaatggtttggcattgagcgagcataggaataactt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19823973 |
acatgctttatacttgaatggtttggcattgagcgagcataggaataactt |
19823923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University