View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7136_high_16 (Length: 217)
Name: NF7136_high_16
Description: NF7136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7136_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 24750140 - 24750339
Alignment:
| Q |
1 |
ggaaaactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750140 |
ggaaaactattcaccgttagtttgataagtttttggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagt |
24750239 |
T |
 |
| Q |
101 |
acccaatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatggatgaaggtggtgccattgcaaacagtgagatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24750240 |
acccaatattcttaacactatgtcacatgatggcatgttcaatgttaagttacattgcaatatcatggatgaaggtggtgccattgcaaacagtgagatc |
24750339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 101
Target Start/End: Original strand, 31330236 - 31330303
Alignment:
| Q |
34 |
tggtatgcatcaaacattggtgtattactattaaacaagtaccttttaagcaactatggtttcaagta |
101 |
Q |
| |
|
|||||| |||| ||||||||||| | ||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
31330236 |
tggtattcatccaacattggtgttcttctattgaacaagtatttgttaagcaactatggtttcaagta |
31330303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University