View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7136_low_16 (Length: 266)
Name: NF7136_low_16
Description: NF7136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7136_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 10559530 - 10559300
Alignment:
| Q |
18 |
gtggagtgtgtttgtttgcttgttgggatgttctgtaatatcctttcggnnnnnnnnnnnnnnncgttgtttctcttagtctggtttcagtcttctagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
10559530 |
gtggagtgtgtttgtttgcttgttgggatgttctgtaatatccttttg--atttttttttttttcgttgtttctcttagtctggtttaagtcttccagac |
10559433 |
T |
 |
| Q |
118 |
ttttgtaaccttcttatgtttaatatgtctgggtgtagcagatggagaccatctgctcctcatttgcttaacaaatataaagaaaaatacaaatgtattt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10559432 |
ttttgtaaccttcttatgtttaatatgtctgggtgtagcagatggtgaccatctgctcctcatttgcttaacaaatataaaaaaaaatacaaatgtattt |
10559333 |
T |
 |
| Q |
218 |
tgttcaaattataagcaaaagtcataatatatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10559332 |
tgttcaaattataagcaaaagtcataatatatt |
10559300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University