View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7137_low_2 (Length: 367)
Name: NF7137_low_2
Description: NF7137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7137_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Original strand, 46973876 - 46974233
Alignment:
| Q |
1 |
tgtcggacttgcatgaccttggttctcaaatggtgatgctacatttaaatgtatgtttattcaagttgtcataaactcatatcatggtgttttattaaaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46973876 |
tgtcggacttgcatgaacttggttctcaaatggtgatgctacatttgaatgtatgtttattcaagttgtcataaactcatatcatggtgttttattaaaa |
46973975 |
T |
|
| Q |
101 |
gtggtcaagtatgattacacgatactttaccaaaacagtaacattggttgaataggacagtgccatttaggaacttccacaacacttgtttatagttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46973976 |
gtggtcaagtatgattacacgatactttaccaaaacagtaacattggttgaataggacagtgccatttaggaacttccacaacacttgtttatagttaca |
46974075 |
T |
|
| Q |
201 |
acttacaactgtgtgatttagactagtgattccatcttaagtttgagtgggattgcttgaattcacatgaagctctttgtatggttgtccatcgttgttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46974076 |
acttacaactgtgtgatttagactagtgattccatcttaagtttgagtgggattgcttgaattcacatgaagctctttgtatggttgtccatagttgttt |
46974175 |
T |
|
| Q |
301 |
ac-tttgatttttgcatcaactttcactctctaaattgcaatcgacactttttctctg |
357 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46974176 |
acttttgatttttgcatcaactttcactctctaaattgcaatcgacactttttctctg |
46974233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University