View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7137_low_6 (Length: 209)
Name: NF7137_low_6
Description: NF7137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7137_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 6172881 - 6173057
Alignment:
| Q |
18 |
atttggagatggaatcaaatcaactaggcataacattatgggtgttgctgtaattgggcatcagctagacaaccgtaaagatggttcctnnnnnnnngaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
6172881 |
atttggagatggaatcaaatcaactaggcataacattatgggtgttgctgtaattgggcatcagctagacgaccgtaaagatggttcctaaaaaaaaaaa |
6172980 |
T |
 |
| Q |
118 |
agttttagagatggaatccacaaatggtaggtttgttctctctctatattctaactatttccatctcacattttctt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6172981 |
agttttagagatggaatccacaaatggtaggtttgttctctctctatattctaactatttccatctcacattttctt |
6173057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 6176986 - 6177019
Alignment:
| Q |
128 |
atggaatccacaaatggtaggtttgttctctctc |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
6176986 |
atggaatccacaaatggtaagtttgttctctctc |
6177019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University