View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7138_high_10 (Length: 207)
Name: NF7138_high_10
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7138_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 38249680 - 38249491
Alignment:
| Q |
1 |
aatacttcgaatagtagctagttttctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgcaactcaagccattccatcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38249680 |
aatacttcgaatagtagctagttttctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgcaactcaagccattccatcttc |
38249581 |
T |
 |
| Q |
101 |
tcttctgcatgcttttgctccgtattgattgtgttcaaactatgttttttcatgcatatttgtgtagtttatcttgccctttttaatatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38249580 |
tcttctgcatgcttttgctccgtattgattgtgttcaaactatgttttttcatgcatatttgtgtagtttatcttgccttttttaatatt |
38249491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 104
Target Start/End: Complemental strand, 18559900 - 18559846
Alignment:
| Q |
53 |
tttccaaactatctttct---gaggaacgcaactcaagccattccatcttctctt |
104 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18559900 |
tttccaaactatctttcttctgaggtacgcaactcaagccatttcatcttctctt |
18559846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University