View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7138_high_9 (Length: 247)

Name: NF7138_high_9
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7138_high_9
NF7138_high_9
[»] chr8 (1 HSPs)
chr8 (18-118)||(36468362-36468462)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 36468462 - 36468362
Alignment:
18 agttagaatgttagaacttggaaatggaggggtggaattctaagaggagaagaagaggagcgtgatgatagcggtggtgtgttactggaggccaggtgga 117  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
36468462 agttagaatgttagaacatggaaatggaggggtggaattctaagaggagaagaagaggagcgtaatgatagcggtggtgtgttactggaggccaggtgga 36468363  T
118 g 118  Q
    |    
36468362 g 36468362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University