View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7138_low_10 (Length: 247)
Name: NF7138_low_10
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7138_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 36468462 - 36468362
Alignment:
| Q |
18 |
agttagaatgttagaacttggaaatggaggggtggaattctaagaggagaagaagaggagcgtgatgatagcggtggtgtgttactggaggccaggtgga |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36468462 |
agttagaatgttagaacatggaaatggaggggtggaattctaagaggagaagaagaggagcgtaatgatagcggtggtgtgttactggaggccaggtgga |
36468363 |
T |
 |
| Q |
118 |
g |
118 |
Q |
| |
|
| |
|
|
| T |
36468362 |
g |
36468362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University