View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7138_low_11 (Length: 234)
Name: NF7138_low_11
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7138_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 53665263 - 53665485
Alignment:
| Q |
20 |
gcaaaggagtgcaacgcgcatctatatttatttataattgatgtggattatacacacaacttcaacattttgattatatcaccgtttcttgtccaagaat |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665263 |
gcaaaggagtgcaatgcgcatctatatttatttatatttgatgtggattatacgcacaacttcaacattttgattatatcaccgtttcttgtccaagaat |
53665362 |
T |
|
| Q |
120 |
ccaccatcc------------------atatatatattactagtaaagtagtaatgtcgatgaatgcaaggaattataatgctttaattatgtaatcctt |
201 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665363 |
ccaccatccatatatatatatatatatatatatatattactggtaaagtagtaatgtcgatgaatgcaaggaattataatgctttaattatgtaatcctt |
53665462 |
T |
|
| Q |
202 |
tgatggcatcactaccaccaaac |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53665463 |
tgatggcatcactaccaccaaac |
53665485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University