View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7138_low_8 (Length: 267)
Name: NF7138_low_8
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7138_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 10559675 - 10559905
Alignment:
| Q |
16 |
ccaaaacaaagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttctcgctggtaagaaaatttgagattctatgtgtttgt |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10559675 |
ccaacacaaagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttcttgctggtaagaaaatttgagattctatgtgtttgt |
10559774 |
T |
|
| Q |
116 |
ttggctcctaacgaattaattgcttacaaagttatattaaattttcatccatgttgctatgcatttcaaattcctaatctaatacatacaaagacgtaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559775 |
ttggctcctaacgaattaattgcttacaaagttatattaaattttcatccatgttgctatgcatttcaaattcctaatctaatacatacaaagacgtaaa |
10559874 |
T |
|
| Q |
216 |
tgaattttattttgaatttcaggtgttcacc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10559875 |
tgaattttattttgaatttcaggtgttcacc |
10559905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 9849670 - 9849598
Alignment:
| Q |
24 |
aagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttctcgctggtaagaaaatt |
96 |
Q |
| |
|
||||||||||| | |||||||||||||||| |||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
9849670 |
aagaatgaatacaatggatgtcactagagagctaaacataatcagaaacacttttctcactggtaagaaaatt |
9849598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 87
Target Start/End: Complemental strand, 10746468 - 10746393
Alignment:
| Q |
12 |
atcaccaaaacaaagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttctcgctggt |
87 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| || ||||| |||||||||| ||||| |||||| |
|
|
| T |
10746468 |
atcaccaaaagaaagaatgaatactgtggatgtcactagagagctcaacataatcagaaaggcctttcttgctggt |
10746393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 19605292 - 19605224
Alignment:
| Q |
23 |
aaagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttctcgctggtaaga |
91 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
19605292 |
aaagaatgaatatagaagatgccactagagagctaaacataatcagaaagacttttctcactggtaaga |
19605224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 7193779 - 7193857
Alignment:
| Q |
12 |
atcaccaaaacaaagaatgaatatattggatgtcactagagaactaaacatgatcagaaaggtttttctcgctggtaag |
90 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| ||||| ||| ||| |||| ||| | || ||||||||||||| |
|
|
| T |
7193779 |
atcaccaaaagaaagaatgaatatagtggatgtcatcagagacttaagcataatcaaaaacgcttatctcgctggtaag |
7193857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 10716414 - 10716365
Alignment:
| Q |
23 |
aaagaatgaatatattggatgtcactagagaactaaacatgatcagaaag |
72 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||| ||||||||| |
|
|
| T |
10716414 |
aaagaatgaatattatggatgtcactagagagctcaacataatcagaaag |
10716365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 53
Target Start/End: Original strand, 12900325 - 12900366
Alignment:
| Q |
12 |
atcaccaaaacaaagaatgaatatattggatgtcactagaga |
53 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12900325 |
atcaccaaaagaaagaatgaatattgtggatgtcactagaga |
12900366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 53
Target Start/End: Original strand, 12933031 - 12933072
Alignment:
| Q |
12 |
atcaccaaaacaaagaatgaatatattggatgtcactagaga |
53 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12933031 |
atcaccaaaagaaagaatgaatattgtggatgtcactagaga |
12933072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 17922854 - 17922813
Alignment:
| Q |
12 |
atcaccaaaacaaagaatgaatatattggatgtcactagaga |
53 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17922854 |
atcaccaaaagaaagaatgaatattgtggatgtcactagaga |
17922813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University