View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7138_low_9 (Length: 251)
Name: NF7138_low_9
Description: NF7138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7138_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 234
Target Start/End: Original strand, 24320331 - 24320558
Alignment:
| Q |
13 |
aatatagagtaagatgggttttgaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaacatcgattgataatgtttc |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24320331 |
aatatagagtaagatgggttttcaagcggaccatcctgattggtggtcgatggtggtttggtacttaaaaatcacctaaaatatcgattgacaatgtttc |
24320430 |
T |
|
| Q |
113 |
ttaaaagtagaagttcacg-----tttttgatctttatgactgaaacgtcgattcgatagaaatgaggaaaaattaa-gggtaataggtgagtcttatgc |
206 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
24320431 |
ttaaaagtagaagttcacgtgtccttcttgatctttatgattgaaacgtcgattagatcgaaatgaggaaaaattaatgggtaatagatgagtcttatgc |
24320530 |
T |
|
| Q |
207 |
acttatattggtttcctcttaactttgt |
234 |
Q |
| |
|
||||||||| |||||||||| ||||||| |
|
|
| T |
24320531 |
acttatattcgtttcctcttgactttgt |
24320558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University