View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_high_1 (Length: 627)
Name: NF7139_high_1
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 457; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 457; E-Value: 0
Query Start/End: Original strand, 1 - 561
Target Start/End: Original strand, 12350767 - 12351327
Alignment:
| Q |
1 |
tgtgttgcctgccacttgggctgtgttaagtattgttgattctagatctaannnnnnngggtggtggatgtgcggtttaagggtggtggattgtgttcgc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12350767 |
tgtgttgcctgtcacttgggctgtgttaagtagtgttgattctagatcta-cttttttgggtggtggatgtgcggtttaagagtggtggattgtgttcgc |
12350865 |
T |
 |
| Q |
101 |
actctctgttcaccattttcggttgcctccaccacgccggtggatctgtagttgctttcaaatggcgttgagattatcgtcagttttgcgattcttttgt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12350866 |
actctctgttcagcattttcggttgcctccaccacgccggtggatctgtagttgctttcaaatggcgttgagattatcgtcagtgttgcgattcttttgt |
12350965 |
T |
 |
| Q |
201 |
gtgttgttgtttaatctggtc-ttcaggatccgagtatgctttttataatcttgagtcagcgaggtgttagatcttttggttttggttatgttgaacata |
299 |
Q |
| |
|
||||| |||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12350966 |
gtgttattgtgtaatctggtccttcacgatccgagtatgctttttataatcttgagtcagcgaggtgttagatcttttggttttggttatgttgaacata |
12351065 |
T |
 |
| Q |
300 |
ttggtcgttttatcatcacgtggtgaccgtaggtcagcgtggtggttgttgatcctggtttcaagaattcatgttcgaatacccttcatggaggaaagtg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12351066 |
ttggtcgttttatcatcacgtggtgaccgtagatcagagtggtggttgttgatcttgatttcaagaattcatgttcgaatacccttcatggaggaaagtg |
12351165 |
T |
 |
| Q |
400 |
gtgttggccacttggttgagttttgtaaccattaacaatgcaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcggta |
499 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12351166 |
gtgttggccacttggttgcgttttgtaaccattaacaatggaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcagta |
12351265 |
T |
 |
| Q |
500 |
atacatggtggtaattgttggtgttaggttgggagttggaacattaaggatgataatgagga |
561 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12351266 |
atacatggtggtgattgttggtgttaggctgggagttggaacattaaggatgataatgagga |
12351327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University