View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_high_18 (Length: 303)
Name: NF7139_high_18
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 38942213 - 38942492
Alignment:
| Q |
19 |
gatggtgctcaaaatacattataatttgccgagtgtagttgaccattgcttgtaaaagaagctgcaagtatagaagctattttaattacaaaccaattca |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38942213 |
gatggtgctcaaaatacattataacttgtagagtgtggttgaccattgattgtaaactaggctgcaagtatagaagctattttaattacaaaccaattca |
38942312 |
T |
 |
| Q |
119 |
caatcacagaaatgcaaaaagcaatgaaatagaacaaaataaccaaaagcataatat-----tatagatgtcctgcattgtcaactaaacatgtttctca |
213 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38942313 |
caatcactgaaatgcaagaagaaatgaaataaaacaaaataaccaaaagcataatatcgtccaatagatgtcttgcattgtcaactaaacatgtttctct |
38942412 |
T |
 |
| Q |
214 |
ttattgaacatcaattgtggctttactcataagaatgtagtatgaatgcagttgtttgtttctcattgcctatacctttg |
293 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38942413 |
ttattgaatatcaattgtggctatactcataagaatgtagtatgaatgcagttgtttgtttctcattgcccatacctttg |
38942492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University