View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_high_31 (Length: 201)
Name: NF7139_high_31
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 32166508 - 32166685
Alignment:
| Q |
19 |
ggagaatgttttatgatacaaagctagtgtgtggatggaaatttatgattcatagttctgttaaattaatatatgaggattcatcgttgagaaataaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32166508 |
ggagaatgttttatgatacaaagctagtgtgtggatggaaatttatgattcatatttctgttaaattaatatatgaggattcattgttgagaaataaatg |
32166607 |
T |
 |
| Q |
119 |
ctttactcaatggaacaaaagtcaataagagaataactagagttgcttgctcagaaagtctctttactctctgcttct |
196 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32166608 |
ctttactcaatggaacaaaagacaataagagaataactagagttgcttgctcagaaagtctctttactctatgcttct |
32166685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University