View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_14 (Length: 369)
Name: NF7139_low_14
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_14 |
 | |
|
| [»] scaffold0170 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0170 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 10223 - 10457
Alignment:
| Q |
1 |
gcaagtacaacaataccaaacccacaagtgaacaaaaaacccacaatgaaaacaaagagaacggcgaaaaccggaaccaatattgggcttaaaaagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10223 |
gcaagtacaacaataccaaacccacaagtgaacaaaaagcccacaatgaaaacaaagagaacggcgaaaaccggaaccaatattgggcttaacaagatga |
10322 |
T |
|
| Q |
101 |
tcattggcgcaaagaggataaaacccatgatggttactacgaatgttaggcatgtgagaaagagagaaatggtgctaactatgaaaagggtgaagaggcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10323 |
tcattggcgcaaagaggataaaacccatgatggttactacgaatgttaggcatgtgagaaagagagaaatggtgcaaactatgaaaagggtgaagaggcc |
10422 |
T |
|
| Q |
201 |
aaagagttgggttgagtttgaaacatgtttcctta |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10423 |
aaagagttgggttgagtttgaaacatgtttcctta |
10457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 296 - 354
Target Start/End: Original strand, 10506 - 10564
Alignment:
| Q |
296 |
gtgtaaggggttggattgagtagtagtggtcagccatggttatttgatggctggaaatt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10506 |
gtgtaaggggttggattgagtagtagtggtcagccatggttatttgatggctggaaatt |
10564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University