View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_16 (Length: 355)
Name: NF7139_low_16
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 149 - 347
Target Start/End: Complemental strand, 27837460 - 27837262
Alignment:
| Q |
149 |
gtataatttagctttgtttgtttcacaatccttggttttgatagtattttgttggatttgtagatgaattgggtaagaaaagatggttgccatgcatcag |
248 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837460 |
gtataatttagctttgtatgtctcacaatccttggttttgatagtattttgttggatttgtagatgaattgggtaagaaaagatggttgccatgcatcag |
27837361 |
T |
|
| Q |
249 |
ctgcagcatcattgccttcattcaagtaagtttgagtttgtttctaccacttcagtttgtgcctaaagtttgatgaaatatttagatttttcctttgct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837360 |
ctgcagcatcattgccttcattcaagtaagtttgagtttgtttctaccacttcagtttgtgcctaaagtttgatgaaatatttagatttttcctttgct |
27837262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 27837589 - 27837508
Alignment:
| Q |
19 |
tattaagcattgctttcttcacnnnnnnngaagaagctattgtatactttttatcatttatgctatattgatataacttaac |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
27837589 |
tattaagcattgctttcttcacaaaaaaagaagaagctactgtatacttttgatcctttacgctatattgatataacttaac |
27837508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University