View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_28 (Length: 292)
Name: NF7139_low_28
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 39 - 276
Target Start/End: Original strand, 43289889 - 43290126
Alignment:
| Q |
39 |
acatcacgaggggagtttgaatcgggtcggggcattgaagcggcgagttcagggaagttgagtatggcggagttacctttgatggcgagagctgccacgt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289889 |
acatcacgaggggagtttgaatcgggtcggggcattgaagcggcgagttcagggaagttgagtatggcggagttacctttgatggcgagagctgccacgt |
43289988 |
T |
 |
| Q |
139 |
catgtgctcgtgctgccatctccggcgtggcaaacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttccccaagc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289989 |
catgtgctcgtgctgccatctccggcgtggcaaacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttccccaagc |
43290088 |
T |
 |
| Q |
239 |
ccgcattcgaactcctctgtaaaccgggtggttgctct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290089 |
ccgcattcgaactcctctgtaaaccgggtggttgctct |
43290126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 132 - 261
Target Start/End: Complemental strand, 33589307 - 33589178
Alignment:
| Q |
132 |
gccacgtcatgtgctcgtgctgccatctccggcgtggcaaacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttc |
231 |
Q |
| |
|
|||||||| ||||| || || ||||| || | ||| ||| | ||||| |||||||| ||| | ||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
33589307 |
gccacgtcgtgtgcacgcgccgccatttcagccgtagcatatgttccaagccagattcgacttttctttcgtggttcacggatttcggatacccattttc |
33589208 |
T |
 |
| Q |
232 |
cccaagcccgcattcgaactcctctgtaaa |
261 |
Q |
| |
|
|||| | ||||||| ||||||||| |||| |
|
|
| T |
33589207 |
cccatgttcgcattctaactcctctataaa |
33589178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University