View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_29 (Length: 284)
Name: NF7139_low_29
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 9 - 270
Target Start/End: Complemental strand, 12149818 - 12149550
Alignment:
| Q |
9 |
cacagacacgaacattgtacacaattgttgtgggcaccggcatgtcccgg-------tgctatatagtttttagttaatgtgttgtgttttatattgcat |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12149818 |
cacagacacgaacattggacacaattgttgtgggcaccggcatgtcccggaccccggtgctatatagtttttagttaatgtgttgtgttttgtattgcat |
12149719 |
T |
|
| Q |
102 |
aggtgaaacaattgttagnnnnnnntgatgaagggcatgttgttgctacttgccgtaatcctgatgcatcaactgggctacttcgtttgaaggatagatt |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149718 |
aggtgaaacaattgttagaaaaaaatgatgaagggcatgttgttgctacttgccgtaatcctgatgcatcaactgggctacttcgtttgaaggatagatt |
12149619 |
T |
|
| Q |
202 |
tgatgatcgacttcaaattttgcctttggatttgactgttgaaagttctattgaggttatgcttctttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149618 |
tgatgatcgacttcaaattttgcctttggatttgactgttgaaagttctattgaggttatgcttctttt |
12149550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University