View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_32 (Length: 267)
Name: NF7139_low_32
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 71 - 256
Target Start/End: Complemental strand, 31856936 - 31856750
Alignment:
| Q |
71 |
tatatgcttcaattcgtcaatgactaaatggagtcatttcaaaatttggtttgtaattacagcttcattctagcctaacctaccaaactatcaaacttgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856936 |
tatatgcttcaattcgtcaatgactaaatgtagtcatttcaaaatttggtttataatcacagcttcattctagcctaacctaccaaactatcaaacttgg |
31856837 |
T |
 |
| Q |
171 |
gcaagtaacaaaacaagactatatcaatagaattgttgagtagtcaaggtagttgaactcct-atatgcatattcaaatctacctat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31856836 |
gcaagtaacaaaacaagactatatcaatagaattgttgagtagtcaaggtagttgaactcctaatatgcatattcaaatctacctat |
31856750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University