View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_35 (Length: 245)
Name: NF7139_low_35
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 4 - 90
Target Start/End: Complemental strand, 32096681 - 32096595
Alignment:
| Q |
4 |
tctttcttcattttgttttccagattaggtttttatgaccattttgaaattgggggtgtctcctttactgttaaaccagtatcagcc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096681 |
tctttcttcattttgttttccagattaggtttttatgaccattttgaaattgggggtgtctcctttactgttaaaccagtatcagcc |
32096595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 32096531 - 32096461
Alignment:
| Q |
154 |
agatatgaacaattttattctataatttttatgcatagtttcatttcagatctttcatgctacagcctaca |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096531 |
agatataaacaattttattctataatttttatgcatagtttcatttcagatctttcatgctacagcctaca |
32096461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University