View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_36 (Length: 243)
Name: NF7139_low_36
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_36 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 30142621 - 30142844
Alignment:
| Q |
19 |
aaggattcattaaaaatgatacatgatacaaattttctagcatggtacatatgcttggatcgcatggaatctatctaactagtcaattgataatatatcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30142621 |
aaggattcattaaaaatgatacatgatacaaattttctagcatggcacatatgcttggatcgcatggaatctatctaactagtcaattgataatatatcc |
30142720 |
T |
 |
| Q |
119 |
ctttgttattttggtgttgctaattcggacttatggaaaaatatataaacaatatgggtttctcttaggtgtcctccatgcaagataatttgcatacctt |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30142721 |
ctttgttattttggtgttgct-attcggacttatggaaaaatatataaacaatatgggtttctcttaggtgtcctccatgcaagataatttgcatacctt |
30142819 |
T |
 |
| Q |
219 |
agttcaaaataattctcattatatt |
243 |
Q |
| |
|
|||||||| | |||||||||||||| |
|
|
| T |
30142820 |
agttcaaagttattctcattatatt |
30142844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University