View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7139_low_43 (Length: 213)
Name: NF7139_low_43
Description: NF7139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7139_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 2484153 - 2484323
Alignment:
| Q |
14 |
atgaattgatattgatattattgatggggctgtcaaggaagatttggtaaatggtggtttgattaaggttggttattctggttgtactttgaattcggtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484153 |
atgaattgatattgatattattgatggggctgtcaaggaagatttggtaaatggtggtttgattaaggttggttattctggttgtactttgaattc---- |
2484248 |
T |
|
| Q |
114 |
tggttcatttggtttggtatgttgacttctcactttgattgtctttctctctttggtttcttcctttctgtttgactgcatatct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2484249 |
----------ggtttggtatgttgacttctcactttgattgtctttctctctttggtttcttcctttctgtttgactgcacatct |
2484323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University