View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7140_high_5 (Length: 258)

Name: NF7140_high_5
Description: NF7140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7140_high_5
NF7140_high_5
[»] chr7 (1 HSPs)
chr7 (10-113)||(1409624-1409727)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 10 - 113
Target Start/End: Original strand, 1409624 - 1409727
Alignment:
10 aacctgtgacccaaagaaaatccaaaatcaaaaacccattaaaaactcatttcttagctgctgggattaataagcttcattggggtttaatttctcgtgg 109  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
1409624 aacctgtgacccaaagaaaattcaaaatcaaaaacccattaaaaactcatttcttagctgctgggattaataagcttcattggggtataatttctcgtgg 1409723  T
110 gtct 113  Q
    ||||    
1409724 gtct 1409727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University