View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7140_low_4 (Length: 263)
Name: NF7140_low_4
Description: NF7140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7140_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 34 - 142
Target Start/End: Complemental strand, 32914046 - 32913938
Alignment:
| Q |
34 |
ataaaataagggagaggttttttagtgtaaaaagtactttagccaaattcaggtgtggttagtaatatgtctgtgtgtgtagcagcagccataaattatt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914046 |
ataaaataagggagaggttttttagtgtaaaaagtactttagccaaattcaggtgtggttagtaatatgtctgtgtgtgtagcagcagccataaattatt |
32913947 |
T |
|
| Q |
134 |
gcaacataa |
142 |
Q |
| |
|
||||||||| |
|
|
| T |
32913946 |
gcaacataa |
32913938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 32913932 - 32913862
Alignment:
| Q |
182 |
tacaagtccacatgatgaacatgtcacaacattagtatcaaaaatatattcggttgctattattctcaccccact |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32913932 |
tacaagtccacatgatgaacatgtcacaacat----atcaaaaatatattcggtcgctattattctcaccccact |
32913862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University