View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7140_low_5 (Length: 258)
Name: NF7140_low_5
Description: NF7140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7140_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 10 - 113
Target Start/End: Original strand, 1409624 - 1409727
Alignment:
| Q |
10 |
aacctgtgacccaaagaaaatccaaaatcaaaaacccattaaaaactcatttcttagctgctgggattaataagcttcattggggtttaatttctcgtgg |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1409624 |
aacctgtgacccaaagaaaattcaaaatcaaaaacccattaaaaactcatttcttagctgctgggattaataagcttcattggggtataatttctcgtgg |
1409723 |
T |
 |
| Q |
110 |
gtct |
113 |
Q |
| |
|
|||| |
|
|
| T |
1409724 |
gtct |
1409727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University