View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7142_low_2 (Length: 463)
Name: NF7142_low_2
Description: NF7142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7142_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 267 - 451
Target Start/End: Complemental strand, 43985163 - 43984980
Alignment:
| Q |
267 |
caaaccgaggagatgtgtttcttaaaacttaaaaggtactgccaaatgtaattaacatatgtcctctgttgcctcctccttcttcgacccatgatcatgt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985163 |
caaaccgaggagatgtgtttcttaaaacttaaaaggtactgcctaatgtaattaacatgtgtcctctgttgcctcctccttcttcgacccatgatcatgt |
43985064 |
T |
|
| Q |
367 |
catcccacgccttctccttcttctttgtgcgatgaccacaccttctccttctccatctaacacattctccctctctgttggttct |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985063 |
catcccacgccttctccttcttctttgtgcgatgaccac-ccttctccttctccatctaacacattctccctctctgttggttct |
43984980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 125 - 238
Target Start/End: Complemental strand, 43985306 - 43985192
Alignment:
| Q |
125 |
taggcattctagtccttgaaattgcaaggtcgatctattagcc-gtccattctccgacgagattctggtagggttgggtgagtttcttagtgttgagaga |
223 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985306 |
taggcattctagtccttgaaattacaaggtcgatctattagcccgtccattctccgacgagattctggtagggttgggtgagtttcttagtgttgagaga |
43985207 |
T |
|
| Q |
224 |
agcaatattgacaca |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43985206 |
agcaatattgacaca |
43985192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 43985404 - 43985331
Alignment:
| Q |
19 |
ctagttttatcgagagatgattgatttgagttgtgtcgactctttgcagcaaggattgcattcagtttatatat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985404 |
ctagttttatcgagagatgattgatttgagttgtatcgactctttgcagcaaggattgcattcagtttatatat |
43985331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 326 - 419
Target Start/End: Complemental strand, 44003082 - 44002989
Alignment:
| Q |
326 |
tgtcctctgttgcctcctccttcttcgacccatgatcatgtcatcccacgccttctccttcttctttgtgcgatgaccacaccttctccttctc |
419 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
44003082 |
tgtcctctgttgcttcctccttcttcgacccatgatcatgttttcccacgccttctccttcttctttgtccgacgaccacagcttctccttctc |
44002989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 338 - 386
Target Start/End: Complemental strand, 8830928 - 8830880
Alignment:
| Q |
338 |
cctcctccttcttcgacccatgatcatgtcatcccacgccttctccttc |
386 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
8830928 |
cctcctccttcttcgaaccacaatcatgtcatcccacaccttctccttc |
8830880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University