View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7142_low_9 (Length: 219)
Name: NF7142_low_9
Description: NF7142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7142_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 39504568 - 39504772
Alignment:
| Q |
1 |
tatggtggaggacagtgaagatatggttggagacggcggttaattgatcgttggtgacaggagcgttggtggtgatggattgggacaggagggttcggag |
100 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504568 |
tatggtggaggacggtgaagatttggttggagacggcggttaattgatcgttggtgacaggagcgttggtggtgatggattgggacaggagggttcggag |
39504667 |
T |
|
| Q |
101 |
agaatcgatgcttgtctgaaccaaggatagattccgaagcggaacctgagggtcgggggtgttacttggattttgttgtggttgaagtatctgggtagtg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504668 |
agaatcgatgctcgtctgaaccaaggatagattccgaagcggaacctgagggtcgggggtgttacttggattttgttgtggttgaagtatctgggtagtg |
39504767 |
T |
|
| Q |
201 |
tgatg |
205 |
Q |
| |
|
||||| |
|
|
| T |
39504768 |
tgatg |
39504772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University