View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7143_high_2 (Length: 482)
Name: NF7143_high_2
Description: NF7143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7143_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 383; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 20 - 406
Target Start/End: Complemental strand, 51863415 - 51863029
Alignment:
| Q |
20 |
atcacaatcgaaacagctcctccgagtataaacggtcttcttctcccaaatcgactcgtacaccgatcactcaaatgcccaaccaagggttgaacaagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51863415 |
atcacaatcgaaacagctcctccgagtataaacggtcttcttctcccaaatcgactcgtacaccgatcactcaaatgcccaaccaagggttgaacaagaa |
51863316 |
T |
 |
| Q |
120 |
gcccagaaagaggcccacataaccatataatgctggcccacgcgtgtgggattccgagctgttgcacatatggtgttagaagagagagttgcaaagccca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51863315 |
gcccagaaagaggcccacataaccatataatgctggcccacgcgtgtgggattccgagctgttgcacatatggtgttagaagagagagttgcaaagccca |
51863216 |
T |
 |
| Q |
220 |
tccgaattgaatcccgccggcgacggatgctactcggagaagctttgtgagtgggacccggtctttgggacgtggtttgattcgaaccgttgaagatgga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51863215 |
tccgaattgaatcccgccggcgacggatgctactcggagaagctttgtgagtaggacccggtctttgggacgtggtttgattcgaaccgttgaagatgga |
51863116 |
T |
 |
| Q |
320 |
gagggtcgaggtttagaccggtggtgttgacggtgagtttcgggattcgccattgtgtggtgtagtggcttggaagattgtattgtg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51863115 |
gagggtcgaggtttagaccggtggtgttgacggtgagtttcgggattcgccattgtgtggtgtagtggcttggaagattgtattgtg |
51863029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 427 - 463
Target Start/End: Complemental strand, 51863005 - 51862969
Alignment:
| Q |
427 |
atcactacattgagaacaagaaatttgtgaccgtttc |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51863005 |
atcactacattgagaacaagaaatttgtgaccgtttc |
51862969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University