View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7143_low_10 (Length: 215)
Name: NF7143_low_10
Description: NF7143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7143_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 38220322 - 38220508
Alignment:
| Q |
18 |
atttagagcttgaaacataatgaaatagtacctaaagaggccaagtgataactgtagagctccagcaaagaatgtagctgtgaaagcaagatgtagaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38220322 |
atttagagcttgaaacataatgaagtagtacctaaagaggccaagtgataactgtagagctccagcaaagaatgtagctgtgaaagcaagatgtagaaaa |
38220421 |
T |
|
| Q |
118 |
agctttgggttctcaattggattaacttcacgacccaacatagatgccatcagaagtgatccaaccgccacagttcccaccaccaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38220422 |
agctttgggttctcaattggattaacttcacgacccaacatagatgccatcagaagtgatccaaccgccacagttcccaccgccaaa |
38220508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 78 - 194
Target Start/End: Complemental strand, 31745810 - 31745694
Alignment:
| Q |
78 |
tccagcaaagaatgtagctgtgaaagcaagatgtagaaaaagctttgggttctcaattggattaacttcacgacccaacatagatgccatcagaagtgat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||| || | | |||||||| ||| ||||||| || |||||||||| ||| |
|
|
| T |
31745810 |
tccagcaaagaatgtagctgtgaaagcaaggtgcagaaaaagctttggattttgggtaggattaacctcattggccaacatggaacccatcagaagagat |
31745711 |
T |
|
| Q |
178 |
ccaaccgccacagttcc |
194 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
31745710 |
ccaactgccacagttcc |
31745694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University