View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7144_low_15 (Length: 355)
Name: NF7144_low_15
Description: NF7144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7144_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 21 - 343
Target Start/End: Original strand, 42275575 - 42275896
Alignment:
| Q |
21 |
gtgggaacaaaaggaagcatatagtttgcaagaggattgggaacataactagagactttgtgcattttgccatcaagttgttttggcttagacttgtaca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275575 |
gtgggaacaaaaggaagcatatagtttgcaagaggattgggaacataactagagactttgtgcattttgccatcaagttgttttggcttagacttgtaca |
42275674 |
T |
 |
| Q |
121 |
aattggtgcaatttttgagctaagagtaggtttctttaaatgaagttgcggtaggaagagaagagaatatggaaagcatcaaaatatgatactacattac |
220 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275675 |
a-ttggtgcaatttttgagctaagagtaggtttctttaaatggagttgcggtaggaagagaagagaatatggaaagcatcaaaatatgatactacattac |
42275773 |
T |
 |
| Q |
221 |
gtgcaggttgttccaatggctttgaagtttgaagaagatctgtgacaatctattgtcttaaagcaaggaccacacgctttattgtacttgctttctattg |
320 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275774 |
gtgcaggttgttgcaatggctttgaagtttgaagaagatctgtgacaatctattgtcttaaagcaaggaccacacgctttattgtacttgctttctattg |
42275873 |
T |
 |
| Q |
321 |
cctttgccaatttggacaatatt |
343 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42275874 |
cctttgccaatttggacaatatt |
42275896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University