View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7144_low_4 (Length: 250)
Name: NF7144_low_4
Description: NF7144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7144_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 95 - 230
Target Start/End: Original strand, 31998109 - 31998244
Alignment:
| Q |
95 |
aactcgtaaaagctcaaaatacgcttctacaagaatcaattttggatgacaaaatttctttgactttatctagccaaacaacataaaaacatcaaatcac |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998109 |
aactcgtaaaagctcaaaatacggttctacaagaataaattttggatgacaaaatttctttgactttatctagccaaacaacataaaaacatcaaatcac |
31998208 |
T |
 |
| Q |
195 |
gtttttcactccagtattacattcaaccaattctat |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31998209 |
gttttttactccagtattacattcaaccaattctat |
31998244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 31997496 - 31997589
Alignment:
| Q |
1 |
gattcaattttagataataaatttataggggcacttaaagttaatagt-aaaaaatatatattagtgtccaactagaatcaatttactttgtct |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997496 |
gattcaattttagataataaatttataggggcacttaaagttaatagtaaaaaaatatatattagtgtccaactagaatcaatttactttgtct |
31997589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University