View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7145_high_16 (Length: 246)
Name: NF7145_high_16
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7145_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 51733392 - 51733164
Alignment:
| Q |
18 |
ccaacatgtcctaggagtggaatttcactggtactacgccgtggtacattcatcaccctttcaacaagcacaactggtatacgcaaaggatctccaaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51733392 |
ccaacatgtcctaggagtggaatttcactggtactacgccgtggtacattcatcaccctttcaacaagcacaactggtatacgcaaaggatctccaaata |
51733293 |
T |
 |
| Q |
118 |
tctgcatgtcttgaattgaacggccgttaatctgcaaaaaagaattgattcatcaataggccgtatctaggagctttgtagcaccgacacaacaccgaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51733292 |
tctgcatgtcttgaattgaacggccgttaatctgcaaaaaagaattgattcatcaataggccatatctaggagctttgtagcaccgacacaacaccgaca |
51733193 |
T |
 |
| Q |
218 |
catctggtaacgttcaattattctatttt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51733192 |
catctggtaacgttcaattattctatttt |
51733164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 54 - 157
Target Start/End: Complemental strand, 356184 - 356081
Alignment:
| Q |
54 |
cgccgtggtacattcatcaccctttcaacaagcacaactggtatacgcaaaggatctccaaatatctgcatgtcttgaattgaacggccgttaatctgca |
153 |
Q |
| |
|
||||||||| ||||| |||| | |||||||| ||||| ||||||||| |||||||||||||| || ||||||||||||||||| || ||||||||||| |
|
|
| T |
356184 |
cgccgtggtgcattcgtcacacgttcaacaatcacaattggtatacgtaaaggatctccaaacatttgcatgtcttgaattgattggttgttaatctgca |
356085 |
T |
 |
| Q |
154 |
aaaa |
157 |
Q |
| |
|
|||| |
|
|
| T |
356084 |
aaaa |
356081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 28452649 - 28452604
Alignment:
| Q |
201 |
ccgacacaacaccgacacatctggtaacgttcaattattctatttt |
246 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||||||||| |||||| |
|
|
| T |
28452649 |
ccgacacaacaccaacacatgtggtaacattcaattattttatttt |
28452604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University