View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7145_low_11 (Length: 316)
Name: NF7145_low_11
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7145_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 7 - 295
Target Start/End: Original strand, 19506618 - 19506906
Alignment:
| Q |
7 |
ttggtgttggggggtgcattcttagagtttccttaactactgcttgaagataaggtaagtttggtatatcagattctttgaaaagcctttctttgccaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506618 |
ttggtgttggggggtgcattcttagagtttccttaactactgcttgaagataaggtaagtttggtatatcagattctttgaaaagcctttctttgccaac |
19506717 |
T |
 |
| Q |
107 |
aattgagtcaatctcttctcttgctttcttgaaaacatgtgggtttcttattagttctgctagtgcccattctaatacacttgctggtccatttgttcct |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506718 |
agttgagtcaatctcttctcttgctttcttgaaaacatgtggatttcttattagttctgctagtgcccattctaatacacttgctggtccatttgttcct |
19506817 |
T |
 |
| Q |
207 |
gcaatgaacatgtcctgttgaacaaacacattaagcaatatgttaaatataccgtaaaattaagggtcttgctaatgaacgcccttagg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19506818 |
gcaatgaacatgtcctgttgaacaaacacattaagcaatatgttaaatataccgtaaaattaagggtcttgctaatgagtgcccttagg |
19506906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University