View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7145_low_12 (Length: 293)
Name: NF7145_low_12
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7145_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 82 - 280
Target Start/End: Complemental strand, 3256242 - 3256040
Alignment:
| Q |
82 |
aaaccaacatgctttaataattggatgattcacttcaaacaactaggtatttgttatttctgcagctaannnnnnnaagtaaattatagcagcggtatct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3256242 |
aaaccaacatgctttaataattggatgattcacttcaaacaactaggtatttgtgatttctgcagctaatttttttaagtaaattatagcagcggtatct |
3256143 |
T |
|
| Q |
182 |
aatgatcataggttttatttataggaaactaataaaaaata----taatattttatattgtggttttaggtctgctatgatgatctgactttgtgtcaca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3256142 |
aatgatcataggttttatttataggaaactaataaaaaatattattaatattttatattgttgttttaggtctgctatgatgatctgactttgtgtcaga |
3256043 |
T |
|
| Q |
278 |
ggt |
280 |
Q |
| |
|
||| |
|
|
| T |
3256042 |
ggt |
3256040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University