View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7145_low_22 (Length: 235)
Name: NF7145_low_22
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7145_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 19506281 - 19506158
Alignment:
| Q |
1 |
tgtctgaagtaggaagggttactgtgtttttggctaaaccattgaagtgcaagcctgttccacattttgttccattctcttctgcctaaggaatttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506281 |
tgtctgaagtaggaagggttactgtgtttttggctaaaccattgaagtgcaagcctgttccacattttgttccattctcttctgcctaaggaatttggat |
19506182 |
T |
 |
| Q |
101 |
caagaatcaaattcatttctcaag |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19506181 |
caagaatcaaattcatttctcaag |
19506158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 19506103 - 19506047
Alignment:
| Q |
179 |
ggaagtgtatgtgaaaacttcttggcaggataaaaataagtgattaggtaatccaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506103 |
ggaagtgtatgtgaaaacttcttggcaggataaaaataagtgattaggtaatccaat |
19506047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University