View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7145_low_25 (Length: 208)
Name: NF7145_low_25
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7145_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 120
Target Start/End: Complemental strand, 35376097 - 35375997
Alignment:
| Q |
20 |
cctagctagtgttatttgtggtacaaaacgcatggcttgtatctcataaattgcaattgctctattgccaataataaaatgttgtattctttagtgtgtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35376097 |
cctagctagtgttatttgtggtacaaaacgcatggcttgtatctcataaattgcaattgctctattgccaataataaaatgttgtattctttagtgtgtg |
35375998 |
T |
|
| Q |
120 |
a |
120 |
Q |
| |
|
| |
|
|
| T |
35375997 |
a |
35375997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University