View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7145_low_25 (Length: 208)

Name: NF7145_low_25
Description: NF7145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7145_low_25
NF7145_low_25
[»] chr1 (1 HSPs)
chr1 (20-120)||(35375997-35376097)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 120
Target Start/End: Complemental strand, 35376097 - 35375997
Alignment:
20 cctagctagtgttatttgtggtacaaaacgcatggcttgtatctcataaattgcaattgctctattgccaataataaaatgttgtattctttagtgtgtg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35376097 cctagctagtgttatttgtggtacaaaacgcatggcttgtatctcataaattgcaattgctctattgccaataataaaatgttgtattctttagtgtgtg 35375998  T
120 a 120  Q
    |    
35375997 a 35375997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University