View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7146_low_13 (Length: 242)
Name: NF7146_low_13
Description: NF7146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7146_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 34473252 - 34473465
Alignment:
| Q |
19 |
tttaacaccaaatttattagcttccctacttagtctattttgtgtatgtgtctatttcatgaatttcaattactaggctaatttgagtttcccttttgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34473252 |
tttaacaccaaatttattagcttccctacttagtctattttgtgtatgtgtctatttcatgaatttcaatttctaggctaatttgagtttcccttttgtt |
34473351 |
T |
 |
| Q |
119 |
cctttgatcttttaagaaatgtagttaagcgcaagaacacacccattggtgtatgcatgttctatgcccatgaaatttatgataattttcaaattagtca |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34473352 |
cctttgatcttttaagaaatgtagttaggcgcaagaacacacccattggtgtatgcatgttctatgcccatgaaatttatgataattttcaaattagtca |
34473451 |
T |
 |
| Q |
219 |
tttcacaggttctg |
232 |
Q |
| |
|
|||| ||| ||||| |
|
|
| T |
34473452 |
tttcccagtttctg |
34473465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University