View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7146_low_15 (Length: 221)
Name: NF7146_low_15
Description: NF7146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7146_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 203
Target Start/End: Complemental strand, 42466884 - 42466702
Alignment:
| Q |
21 |
aagccaatgacaaatgatgcaacacattaattatgcaagaaaaaaggttgaatttggatcacaaaattatgcagttgttgacctatattgtatcaagatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42466884 |
aagccaatgacaaatgatgcaacacattaattatgcaagaaaaaaggttgaatttggatcacaaaatcatgcagttgttgacctatattgtatcaagatt |
42466785 |
T |
 |
| Q |
121 |
ggatgattcatatttcaacttcacattttagacgcaatttactaaagctgaagcatgaactacctctctttgatttgaccgtt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
42466784 |
ggatgattcatatttcaacttcacattttagacgcaatttactaaagcttaagcatgaactacctctttttgatttgaccgtt |
42466702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University