View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7146_low_15 (Length: 221)

Name: NF7146_low_15
Description: NF7146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7146_low_15
NF7146_low_15
[»] chr4 (1 HSPs)
chr4 (21-203)||(42466702-42466884)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 21 - 203
Target Start/End: Complemental strand, 42466884 - 42466702
Alignment:
21 aagccaatgacaaatgatgcaacacattaattatgcaagaaaaaaggttgaatttggatcacaaaattatgcagttgttgacctatattgtatcaagatt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
42466884 aagccaatgacaaatgatgcaacacattaattatgcaagaaaaaaggttgaatttggatcacaaaatcatgcagttgttgacctatattgtatcaagatt 42466785  T
121 ggatgattcatatttcaacttcacattttagacgcaatttactaaagctgaagcatgaactacctctctttgatttgaccgtt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||    
42466784 ggatgattcatatttcaacttcacattttagacgcaatttactaaagcttaagcatgaactacctctttttgatttgaccgtt 42466702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University