View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7147_high_15 (Length: 254)

Name: NF7147_high_15
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7147_high_15
NF7147_high_15
[»] chr3 (2 HSPs)
chr3 (146-254)||(16006067-16006175)
chr3 (86-127)||(16006194-16006235)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 146 - 254
Target Start/End: Complemental strand, 16006175 - 16006067
Alignment:
146 gcatacatgtgttaaaattggaagtgcacgtgtaatcaatttttatcaaattttaaagtcaactgaaccttggttaattatttggaagtattaaacaata 245  Q
    |||||||| ||||||||||||||||||||||||||||||||||||  |||||| |||||||||||||||||||||||||| |||||||||||||||||||    
16006175 gcatacatatgttaaaattggaagtgcacgtgtaatcaatttttaagaaatttcaaagtcaactgaaccttggttaattaattggaagtattaaacaata 16006076  T
246 aggtaattt 254  Q
    |||||||||    
16006075 aggtaattt 16006067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 86 - 127
Target Start/End: Complemental strand, 16006235 - 16006194
Alignment:
86 attatatggtcaaatgttattcaacttacatacgttcctaac 127  Q
    ||||| |||||||||||||||||||||||||| |||||||||    
16006235 attatgtggtcaaatgttattcaacttacatatgttcctaac 16006194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University