View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7147_low_16 (Length: 254)
Name: NF7147_low_16
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7147_low_16 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 146 - 254
Target Start/End: Complemental strand, 16006175 - 16006067
Alignment:
| Q |
146 |
gcatacatgtgttaaaattggaagtgcacgtgtaatcaatttttatcaaattttaaagtcaactgaaccttggttaattatttggaagtattaaacaata |
245 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16006175 |
gcatacatatgttaaaattggaagtgcacgtgtaatcaatttttaagaaatttcaaagtcaactgaaccttggttaattaattggaagtattaaacaata |
16006076 |
T |
|
| Q |
246 |
aggtaattt |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
16006075 |
aggtaattt |
16006067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 86 - 127
Target Start/End: Complemental strand, 16006235 - 16006194
Alignment:
| Q |
86 |
attatatggtcaaatgttattcaacttacatacgttcctaac |
127 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16006235 |
attatgtggtcaaatgttattcaacttacatatgttcctaac |
16006194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University