View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7147_low_19 (Length: 242)
Name: NF7147_low_19
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7147_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 16005612 - 16005791
Alignment:
| Q |
23 |
cgatgctggcctaaatgcagttccatatgagggtgcttatgaaaaaatgcgaggaatgcatgatgggttagcagctggtcaacttgctcaagatgaaaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005612 |
cgatgctggcctaaatgcagttccatatgagggtgcttatgaaataatgcgaggaatgcatgatgggttagcagctggtcaacttgctcaagatgaaaat |
16005711 |
T |
 |
| Q |
123 |
gcacagattgcacatgatgttggggcaaatcaagcacaagaagttgcagaaaatcttggcgcagaagaaaatgcacaggt |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
16005712 |
gcacagattgcacatgttgttggggcaaatcaagcacaagaagttgtagaaaatcttgaggcagaagaaaatgcacaggt |
16005791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Original strand, 16005803 - 16005831
Alignment:
| Q |
199 |
aggtagaacaagctgaagaagttgcacag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16005803 |
aggtagaacaagctgaagaagttgcacag |
16005831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University