View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7147_low_21 (Length: 238)
Name: NF7147_low_21
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7147_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 35964091 - 35964033
Alignment:
| Q |
164 |
ccttctgattcttttttagcttggaaagctttagaagtatacgctttgcgtttgacttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35964091 |
ccttctgattcttttttagcttggaaagctttagaagtagacgctttgcgtttgacttg |
35964033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 35964242 - 35964159
Alignment:
| Q |
16 |
gagaaggtaaaattcatccccactatgctccattgtgatgcctagttgttaaagaacatcttaagaacactcgttaacatttcc |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||| ||||||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
35964242 |
gagaaggtaaaattcatccccattatgccctattgtcatgcctaattgttaaagagtatcttaagaacattcgttaacatttcc |
35964159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University