View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7147_low_21 (Length: 238)

Name: NF7147_low_21
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7147_low_21
NF7147_low_21
[»] chr2 (2 HSPs)
chr2 (164-222)||(35964033-35964091)
chr2 (16-99)||(35964159-35964242)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 35964091 - 35964033
Alignment:
164 ccttctgattcttttttagcttggaaagctttagaagtatacgctttgcgtttgacttg 222  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35964091 ccttctgattcttttttagcttggaaagctttagaagtagacgctttgcgtttgacttg 35964033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 35964242 - 35964159
Alignment:
16 gagaaggtaaaattcatccccactatgctccattgtgatgcctagttgttaaagaacatcttaagaacactcgttaacatttcc 99  Q
    |||||||||||||||||||||| ||||| | ||||| ||||||| ||||||||||  |||||||||||| ||||||||||||||    
35964242 gagaaggtaaaattcatccccattatgccctattgtcatgcctaattgttaaagagtatcttaagaacattcgttaacatttcc 35964159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University