View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7147_low_5 (Length: 384)
Name: NF7147_low_5
Description: NF7147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7147_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 31458149 - 31457979
Alignment:
| Q |
16 |
tttatcacaacattagttaattatttcaaagcaaatatttcaccgtccacgaccattaacctcaccatctttctttataaatagtgaaccagttatacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31458149 |
tttatcacaacattagttaattatttcaaagcaaatatttcaccgtccacgaccattaacttcaccatctttctttataaatagcgaaccagttatacta |
31458050 |
T |
|
| Q |
116 |
tgtttgtacaataccactatccatttagaaaattcttatatttcaaattgtttttgtgatcatttgaaaca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31458049 |
tgtttgtacaataccactatccatttagaaaattcttatatttcaaattgtttttgtgatcatttgaaaca |
31457979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 236 - 381
Target Start/End: Complemental strand, 31457929 - 31457781
Alignment:
| Q |
236 |
cgcaaaaggaggcggcggt---ggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcaccgggaggtggtggatcatacatatct |
332 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31457929 |
cgcaaaaggaggcggtggtaccggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcacctggaggtggtggatcatacatatct |
31457830 |
T |
|
| Q |
333 |
cgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcatt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31457829 |
cgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcatt |
31457781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 238 - 380
Target Start/End: Complemental strand, 49085873 - 49085731
Alignment:
| Q |
238 |
caaaaggaggcggcggtggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcaccgggaggtggtggatcatacatatctcgtgg |
337 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085873 |
caaaaggaggcggtggtggaagcaaagggtccaccggtggcagtggtggtggagattcaatgaaagcaccgggaggtggtggatcatacatatctcgtgg |
49085774 |
T |
|
| Q |
338 |
tgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
380 |
Q |
| |
|
||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
49085773 |
tgcatttgaaagcaacccacaaggctattttggtggtcttcat |
49085731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 51 - 186
Target Start/End: Complemental strand, 49086081 - 49085937
Alignment:
| Q |
51 |
tatttcaccgtccacgaccattaacctcaccatctttctttataaatagtgaaccagttatactatgtttgtac-------aataccactatccattt-- |
141 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| ||| ||| ||||||| || ||||||||||| ||||||||| ||||| || |||||||| |
|
|
| T |
49086081 |
tatttcaccggccacgaccattaacttcaccattttt-tttctaaatagggagccagttatactgtgtttgtactttgtacaatactaccatccatttct |
49085983 |
T |
|
| Q |
142 |
-agaaaattcttatatttcaaattgtttttgtgatcatttgaaaca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49085982 |
tagaaaattcttatatttcaaattgtttttgtgatcgtttgaaaca |
49085937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University