View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7149_low_3 (Length: 269)
Name: NF7149_low_3
Description: NF7149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7149_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 197
Target Start/End: Complemental strand, 29606490 - 29606313
Alignment:
| Q |
20 |
cagatgttggagttgtagtttttggaactattggtttcacaggtgcagctgttggagttgtaactttgggaaccagtggtttagccggtgcaaccgttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606490 |
cagatgttggagttgtagtttttggaactattggtttcacaggtgcagctgttggagttgtaactttgggaaccagtggtttagccggtgcaaccgttgg |
29606391 |
T |
|
| Q |
120 |
agttgcaacctttggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaactggtgacttcacggg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606390 |
agttgcaacctttggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaactggtgacttcacggg |
29606313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 183
Target Start/End: Complemental strand, 29606512 - 29606462
Alignment:
| Q |
133 |
ggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaact |
183 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
29606512 |
ggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaact |
29606462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University