View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7149_low_6 (Length: 290)
Name: NF7149_low_6
Description: NF7149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7149_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 9e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 127 - 269
Target Start/End: Original strand, 41209540 - 41209682
Alignment:
| Q |
127 |
caaaacactcagaagaccagtactgtattttaaacgagagaaagtatcacaaaacatccttggagaaatgcacctgttccaaataattacttcatgattg |
226 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41209540 |
caaaacactcagaagactagtactgtattttaaacgagagaaagtatcacaaaacatccttggagaaatgcacctgttccaaataattacttcatgattg |
41209639 |
T |
|
| Q |
227 |
ctggaagtttaaatatttgatgtagttacagtgtttaatgcaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41209640 |
ctggaagtttaaatatttgatgtagttacagtgtttaatgcaa |
41209682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 79 - 132
Target Start/End: Original strand, 41208787 - 41208840
Alignment:
| Q |
79 |
tagtttttaccatttaaaaagcacttctaaaatatccaaaagtgataccaaaac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41208787 |
tagtttttaccatttaaaaagcacttctaaaatatccaaaagtgataccaaaac |
41208840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 41208325 - 41208400
Alignment:
| Q |
11 |
aaaattgctattagtcccctaagttgattgctcgaaaaaatatcaaacataattttgtagagttaaaatagttttta |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
41208325 |
aaaattgcttatagtcccctaagttgattgctcgaaaaaatatcaaacataattttatag-ttaaaaatagttttta |
41208400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 108
Target Start/End: Original strand, 46357 - 46449
Alignment:
| Q |
15 |
ttgctattagtcccctaagttgattgctcgaaaaaatatcaaacataattttgtagagttaaaatagtttttaccatttaaaaagcacttctaa |
108 |
Q |
| |
|
||||| ||||||||| || |||||| ||| ||||||| |||||| ||||||| | |||||| ||| |||||| | ||||||||||||||||| |
|
|
| T |
46357 |
ttgcttttagtccccaaaattgatttctc-aaaaaatgtcaaacgtaattttatggagttagaattgtttttggtacttaaaaagcacttctaa |
46449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University