View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7150_high_10 (Length: 341)
Name: NF7150_high_10
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7150_high_10 |
 |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 13715596 - 13715916
Alignment:
| Q |
1 |
acaccctcttattcgtaactggtcattagttagaagcttatgatgagccaatctccaaacaaatgaaggcccgannnnnnnnnnnnnnnnatgtgggggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
13715596 |
acaccctcttattcgtaactggtcatcagttagaagcttttgatgagccaatctttaaacaaatgaaggcccgagtgtgtgtgtgtgt--atgtgggggg |
13715693 |
T |
 |
| Q |
101 |
tggggacaaaggcatttcaaataaacttgcaccaactcaacttgattcgtattcagaaaatcataagctaacttgttggacaaatccccatccatagagt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13715694 |
tggggacaaaggcattccaaataaacttgcaccaactcaacttgattcgtattcagaaaatcataagctaacttgttagacaaatccccatccatagagt |
13715793 |
T |
 |
| Q |
201 |
gaagccaatgcaaacagtcattttgaggttcaatgcaaagagtcgtattttgtatcagcaccgtcaaagtaggatatttacggctaatgtatgagggaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13715794 |
gaagccaatgcaaacagtcattttgaggttcaatgcaaagagtggtattttgtatcagcaccgtcaaagtaggatatttagggctaatgtatgagggaat |
13715893 |
T |
 |
| Q |
301 |
ctgccattgttggtgcacaatgt |
323 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
13715894 |
ctgccattgttggtgcacgatgt |
13715916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 323
Target Start/End: Original strand, 36099 - 36184
Alignment:
| Q |
238 |
aagagtcgtattttgtatcagcaccgtcaaagtaggatatttacggctaatgtatgagggaatctgccattgttggtgcacaatgt |
323 |
Q |
| |
|
|||||| |||||||||||| | |||||||| |||||||||||| |||||||| | ||||||| ||||||| ||||||| ||||| |
|
|
| T |
36099 |
aagagtggtattttgtatctgaaccgtcaaggtaggatatttagaactaatgtaggtgggaatccgccattgatggtgcagaatgt |
36184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University