View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7150_high_21 (Length: 222)

Name: NF7150_high_21
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7150_high_21
NF7150_high_21
[»] chr5 (2 HSPs)
chr5 (32-209)||(42326724-42326901)
chr5 (38-94)||(42319458-42319514)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 32 - 209
Target Start/End: Complemental strand, 42326901 - 42326724
Alignment:
32 ggaggaggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgttctcttcttattttcgttgttcatgcatggaggagttt 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
42326901 ggaggaggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgttctcttcttattttcgttgttcatgcatggacgagttt 42326802  T
132 gttttttgttttaataaattatgacttgttagaattggtatttgtaattactcgtttattgggattcatgttcatatt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42326801 gttttttgttttaataaattatgacttgttagaattggtatttgtaattactcgtttattgggattcatgttcatatt 42326724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 42319514 - 42319458
Alignment:
38 ggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgtt 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42319514 ggaggaaggccgttcttgggttatgcgccaccgccattgttctagttcagtattgtt 42319458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University