View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7150_low_20 (Length: 257)

Name: NF7150_low_20
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7150_low_20
NF7150_low_20
[»] chr7 (1 HSPs)
chr7 (11-227)||(38330680-38330893)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 38330893 - 38330680
Alignment:
11 agaatatctaataaaccatgttaatagaagcaaataattgaataagcaactaaacaaatccaaaccgttaatataatattcttgcatcatcaaacatact 110  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38330893 agaatatctaataaaccatgttaatataagcaaataattgaataagcaactaaacaaatccaaaccgttaatataatattcttgcatcatcaaacatact 38330794  T
111 ttttctaatgacggatcgatcactaaagatgttacatatttatcatttgtcnnnnnnnnnnnnnntggtgcatattttgcgcacaaattagcatgtgtct 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||              |||| |||||||||||||||||||||||||||||     
38330793 ttttctaatgacggatcgatcactaaagatgttacatatttatcatttgtc---aaaaaaaaaaatggtacatattttgcgcacaaattagcatgtgtcc 38330697  T
211 taaaacatgcgatctaa 227  Q
    |||||||||||||||||    
38330696 taaaacatgcgatctaa 38330680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University