View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7150_low_20 (Length: 257)
Name: NF7150_low_20
Description: NF7150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7150_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 38330893 - 38330680
Alignment:
| Q |
11 |
agaatatctaataaaccatgttaatagaagcaaataattgaataagcaactaaacaaatccaaaccgttaatataatattcttgcatcatcaaacatact |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38330893 |
agaatatctaataaaccatgttaatataagcaaataattgaataagcaactaaacaaatccaaaccgttaatataatattcttgcatcatcaaacatact |
38330794 |
T |
 |
| Q |
111 |
ttttctaatgacggatcgatcactaaagatgttacatatttatcatttgtcnnnnnnnnnnnnnntggtgcatattttgcgcacaaattagcatgtgtct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
38330793 |
ttttctaatgacggatcgatcactaaagatgttacatatttatcatttgtc---aaaaaaaaaaatggtacatattttgcgcacaaattagcatgtgtcc |
38330697 |
T |
 |
| Q |
211 |
taaaacatgcgatctaa |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38330696 |
taaaacatgcgatctaa |
38330680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University